자료유형
전체 선택해제
총 46건 검색
본문검색 결과만 보기
-
Pituitary Adenylate Cyclase-activating Polypeptide Inhibits Pacemaker Activity of Colonic Interstitial Cells of Cajal
MeiJinWu, KeunHongKee, JisunNa, SeokWonKim, YouinBae, DongHoonShin, SeokChoi, JaeYeoulJun, Han-SeongJeong, Jong-SeongPark 대한생리학회-대한약리학회 The Korean Journal of Physiology & Pharmacology 6 Pages
대한생리학회-대한약리학회 The Korean Journal of Physiology & Pharmacology 2015, Vol.19 No.5 6 435-440 (6 pages)
on pace- maker activity in small intestinal ICC [26]. Also, pretreat- ment with an adenylate cyclas e inhibitor does not influence prostaglandin E 2 (PGE2) action on pacemaker currents, and PGE2 does not stimulate the prod uction of cAMP [27]. This suggests that inhibition of pacemaker activity by PACAP does not use the common pathway (cAMP-mediated) in co- lonic ICC. Next, we focused on the... This study aimed to investigate the effect of pituitary adenylate cyclase-activating peptide (PACAP) on the pacemaker activity of interstitial cells of Cajal (ICC) in mouse colon and to identify the underlying mechanisms of PACAP action. Spontaneous pacemaker activity of colonic ICC and the effects of PACAP were studied using electrophysiological recordings. Exogenously applied PACAP induced hyperpolarization of the cell membrane and inhibited pacemaker frequency in a dose-dependent manner (from... -
Mechanism of Pituitary Adenylate Cyclase-Activating Polypeptide- Induced Inhibition on Catecholamine Secretion Evoked by Cholinergic Stimulation and Membrane Depolarization in the Rat Adrenal Gland
Dong-YoonLim, Jeong-WonKang, Young-JoKim 대한생리학회-대한약리학회 The Korean Journal of Physiology & Pharmacology 12 Pages
대한생리학회-대한약리학회 The Korean Journal of Physiology & Pharmacology 1999, Vol.3 No.3 12 339-350 (12 pages)
to activate adenylate cylcase in PC-12 cells and several other cell types (Myata et al， 1989; Watanabe et al， 1990). In support of this finding， Isobe and his coworkers (1993) have demonstrated that the cAMP messenger system dose not mediate the immediate effect of PACAP on CA secretion in cu1tured porcine adrenal medullary cells. In their studies， first1y， forskolin， an activator of... The present study was attempted to examine the effect of pituitary adenylate cyclase-activating polypeptide (PACAP) on catecholamine (CA) secretion evoked by cholinergic stimulation, membrane depolarization and calcium mobilization from the isolated perfused rat adrenal gland. The perfusion of PACAP (10 nM) into an adrenal vein for 60 min produced a great inhibition in CA secretion evoked by ACh (5.32⁓103 M), high K (5.6⁓102 M), DMPP (104 M for 2 min),... -
Platelet Activating Factor에 의한 대식세포의 활성화에 있어서 칼슘과 Protein Kinase C의 역할
이정수(Chung-Soo Lee), 김영준(Young-Jun Kim), 신용규(Yong-Kyoo Shin), 이광수(Kwang-Soo Lee) 대한약리학회 대한약리학잡지 14 Pages
대한약리학회 대한약리학잡지 1993, 제 29권 제 1호 11 107-120 (14 pages)
the G protein which in turn can activate either phospholipase C (MacIntyre and Pollock, 1983; Hallam et al., 1984) or can inhibit adenylate cyclase (Haslam and Vanderwel, 1982; Hwang et al., 1986). The G pro- teins, phospholipase C and adenylate cyclase ap- pear to mediate the action of P AF in various cells and tissues (Shimizu et al., 1992). PAF may pro- mote inflammatory responses from the... 입자 또는 용해성 자극 물질들은 칼슘 이동의 변화와 protein kinase C의 활성화를 초래하여 식 세포의 반응을 자극하는 것으로 추정하고 있다. 이에 비해서 protein kinase C가 활성화되면 호중구에서 agonist에 의한 세포 칼슘 농도의 증가가 억제된다고 보고하고 있다. PAF는 peritoneal macrophage에서 세포내 칼슘 농도를 용량에 따라 증가시켰으며 칼슘의 유출이 동반되었다. PAF에 의한 세포내 칼슘 농도의 증가는 TMB-8, verapamil과 TTX의 영향을 받지 않았다. TEA는 PAF에 의한 세포내 칼슘 이동을 자극하였으며 세포내 칼슘... -
MDL-12330A potentiates TRAIL-induced apoptosis in gastric cancer cells through CHOP-mediated DR5 upregulation
Sung-ChulLimSongIyHan 대한생리학회-대한약리학회 The Korean Journal of Physiology & Pharmacology 9 Pages
대한생리학회-대한약리학회 The Korean Journal of Physiology & Pharmacology 2017, Vol.21 No.4 5 397-405 (9 pages)
by immunoblotting with an antibody to CHOP (B), and to BiP and p-PERK (C). Alpha-tubulin was used as a loading control. Fig. 5. Antitumor effect of MDL12330A is not linked to inhibition of adenylate cyclase activity. (A) SNU601 and SNU638 cells were exposed to other type of adenylate cyclase inhibitors NKY80 and NB001 at indicated concentrations for 24 h, and cell viability was assessed by the... a novel antitumor activity of this drug in gastric carcinoma (GC) cell lines. In these GC cells, MDL-12330A reduced cell viability and induced cell death in a concentration-dependent manner. At a moderate concentration (~20 μM), MDL-12330A mainly induced apoptotic death whereas at concentrations greater than 20 μM, it increased non-apoptotic cell death. The induction of apoptosis was at least partially regulated by CHOP-mediated DR5 upregulation, as detected by immunoblotting and gene... -
NecroX-5 protects mitochondrial oxidative phosphorylation capacity and preserves PGC1α expression levels during hypoxia/ reoxygenation injury
VuThiThu, HyoungKyuKim, LeThanhLong, BayalagmaaNyamaa, In-SungSong, ToThanhThuy, NguyenQuangHuy, JubertMarquez, SoonHaKim, NariKim, KyungS 대한생리학회-대한약리학회 The Korean Journal of Physiology & Pharmacology 11 Pages
대한생리학회-대한약리학회 The Korean Journal of Physiology & Pharmacology 2016, Vol.20 No.2 9 201-211 (11 pages)
of Adenylate kinase 2, mitochondrial agcaggctgaaatgcttgat aagcggagtggtctgagtgt LUM Lumican tgcagtggctcattcttgac cctcctctttgagctggttg CABC1 Chaperone activity of bc1 complex-like, mitochondrial tctggaagccgaagttcagt gagccttccattgactctgc NEXN Nexilin aagaaaaccgcaagaagcaa cagcaaatgccttcttctcc ..PAGE:4 204 http://dx.doi.org/10.4196/kjpp.2016.20.2.201 Korean J Physiol Pharmacol 2016;20(2):201-211 Thu VT... system. Proteomic analysis was performed using liquid chromatography-mass spectrometry (LC-MS) and non-labeling peptide count protein quantification. Real-time PCR, western blot, citrate synthases and mitochondrial complex activity assays were then performed to assess heart function. Treatment with NecroX-5 during hypoxia significantly preserved electron transport chain proteins involved in oxidative phosphorylation and metabolic functions. NecroX-5 also improved mitochondrial complex I, II, and... -
cAMP induction by ouabain promotes endothelin-1 secretion via MAPK/ERK signaling in beating rabbit atria
Li-qunPeng, PingLi, Qiu-liZhang, LanHong, Li-pingLiu, XunCui, Bai-riCui 대한생리학회-대한약리학회 The Korean Journal of Physiology & Pharmacology 6 Pages
대한생리학회-대한약리학회 The Korean Journal of Physiology & Pharmacology 2016, Vol.20 No.1 2 9-14 (6 pages)
vs. the control period. ouabain (3.0 mmol/L)), please correct it as ouabain (3.0 mmol/L). Fig. 2. Effects of forskolin (A) and theophyline (B) on ouabain- induced atrial adenylate cyclase activity in rabbit atria. Data are presented as the means±SE (n=6). **p<0.01, ***p<0.001 vs. control; #p<0.05, ◆◆p<0.01 vs. ouabain. ..PAGE:4 12 http://dx.doi.org/10.4196/kjpp.2016.20.1.9 Korean J Physiol... Adenosine 3',5'-cyclic monophosphate (cAMP) participates in the regulation of numerous cellular functions, including the Na+-K+-ATPase (sodium pump). Ouabain, used in the treatment of several heart diseases, is known to increase cAMP levels but its effects on the atrium are not understood. The aim of the present study was to examine the effect of ouabain on the regulation of atrial cAMP production and its roles in atrial endothelin-1 (ET-1) secretion in isolated perfused beating rabbit atria.... -
Activation of G Proteins by Aluminum Fluoride Enhances RANKL- Mediated Osteoclastogenesis
BoryungPark, Yu-MiYang, Byung-JaiChoi, MinSeukKim, DongMinShin 대한생리학회-대한약리학회 The Korean Journal of Physiology & Pharmacology 7 Pages
대한생리학회-대한약리학회 The Korean Journal of Physiology & Pharmacology 2013, Vol.17 No.5 8 427-433 (7 pages)
entiation resulting from the loss of [Ca 2＋]i oscillation regu- lation. Genes Dev. 2007;21:1803-1816. 27. Sternweis PC, Northup JK, Smigel MD, Gilman AG. The regulatory component of adenylate cyclase. Purification and properties. J Biol Chem. 1981;256:11517-11526. 28. Carter RH, Park DJ, Rhee SG, Fearon DT. Tyrosine phos- phorylation of phospholipase C induced by membrane immu- noglobulin in B... Receptor activator of NF-ՊB ligand (RANKL)-induced osteoclastogenesis is accompanied by intra-cellular Ca2＋ mobilization in a form of oscillations, which plays essential roles by activating sequen-tially Ca2＋/calmodulin-dependent protein kinase, calcineurin and NFATc1, necessary in the osteoclast differentiation. However, it is not known whether Ca2＋ mobilization which is evoked in RANKL-in-dependent way induces to differentiate into osteoclasts. In present study, we investigated Ca2＋... -
Modulation of Presynaptic GABA Release by Oxidative Stress in Mechanically-isolated Rat Cerebral Cortical Neurons
Eu-TeumHahm, Jung-WooSeo, JinyoungHur, Young-WukCho 대한생리학회-대한약리학회 The Korean Journal of Physiology & Pharmacology 6 Pages
대한생리학회-대한약리학회 The Korean Journal of Physiology & Pharmacology 2010, Vol.14 No.3 2 127-132 (6 pages)
adenylate cyclase activation on the potenti- ating effect of H 2O 2 on mIPSCs Activation of adenylate cyclase can increase cAMP for- mation and then potentiates presynaptic neurotransmitter release. Thus, we examined the effect of forskolin, an ad- enylyl cyclase activator, on the potentiating effect of H2O2 on GABAergic mIPSCs. Forskolin (10 μM) significantly in- creased the mIPSC frequency to... mIPSCs. This potentiating effect of H2O2 was blocked by the pretreatment with either 10,000-unit/mL catalase or 300-ՌM N-acetyl-cysteine. The potentiating effect of H2O2 was occluded by an adenylate cyclase activator, forskolin, and was blocked by a protein kinase A inhibitor, N-(2-[p-bromocinnamylamino] ethyl)-5-isoquinolinesulfonamide hydrochloride. This study indicates that oxidative stress may potentiate presynaptic GABA release through the mechanism of cAMP-dependent protein kinase A... -
P2 Receptor-mediated Inhibition of Vasopressin-stimulated Fluid Transport and cAMP Responses in AQP2-transfected MDCK Cells
YangHooKim, YoungJinChoi, HaeRahnBae, JaeSukWoo 대한생리학회-대한약리학회 The Korean Journal of Physiology & Pharmacology 6 Pages
대한생리학회-대한약리학회 The Korean Journal of Physiology & Pharmacology 2009, Vol.13 No.1 2 9-14 (6 pages)
of adenylate cyclase by IL 2 in human T lymphocytes is mediated by protein kinase C. Biochem Biophys Res Commun 145: 176 182, 1987. Budnik LT, Mukhopadhyay AK. Desensitisation of LH-stimulated cyclic AMP accumulation in isolated bovine luteal cells-effect of phorbol ester. Mol Cell Endocrinol 54: 51 61, 1987. Buhl AM, Sheikh MI, Steensgaard J, Roigaard-Petersen H, Jacobsen C. GTP-binding... We cultured canine kidney (MDCK) cells stably expressing aquaporin-2 (AQP2) on collagen-coated permeable membrane filters and examined the effect of extracellular ATP on arginine vasopressin (AVP)-stimulated fluid transport and cAMP production. Exposure of cell monolayers to basolateral AVP resulted in stimulation of apical to basolateral net fluid transport driven by osmotic gradient which was formed by addition of 500 mM mannitol to basolateral bathing solution. Pre-exposure of the basolateral...