발행기관
- 한국식물병리학회(9)
- 대한수의학회(5)
- 한국교육학회(4)
- 대한생리학회-대한약리학회(3)
- 인문사회과학기술융합학회(3)
- 디지털스토리텔링학회(2)
- 환태평양유아교육연구학회(2)
- 경인교육대학교 교육연구원(1)
- 대한조선학회(1)
- 한국경호경비학회(1)
- 한국교육사회학회(1)
- 한국기초간호학회(1)
- 한국멀티미디어학회(1)
- 한국생물정보시스템생물학회(1)
- 한국정보관리학회(1)
- 한국정보통신학회(1)
- 한국지능정보시스템학회(1)
- 한국컴퓨터정보학회(1)
간행물
- THE PLANT PATHOLOGY JOURNAL (9)
- JOURNAL OF VETERINARY SCIENCE(3)
- THE KOREAN JOURNAL OF PHYSIOLOGY & PHARMACOLOGY(3)
- 교육학연구(3)
- 예술인문사회융합멀티미디어논문지(3)
- ASIA-PACIFIC JOURNAL OF RESEARCH IN EARLY CHILDHOOD EDUCATION(2)
- 대한수의학회 학술대회발표집(2)
- 디지털스토리텔링연구(2)
- INTERDISCIPLINARY BIO CENTRAL(1)
- INTERNATIONAL JOURNAL OF MARITIME INFORMATION AND COMMUNICATION SCIENCES(1)
- JOURNAL OF KOREAN BIOLOGICAL NURSING SCIENCE(1)
- JOURNAL OF SHIP AND OCEAN TECHNOLOGY(1)
- THE JOURNAL OF EDUCATION(1)
- 교육사회학연구(1)
- 멀티미디어학회논문지(1)
- 시큐리티연구(1)
- 정보관리학회지(1)
- 지능정보연구(1)
- 한국교육학회 학술대회논문집(1)
- 한국컴퓨터정보학회논문지(1)
전체 선택해제
총 39건 검색
본문검색 결과만 보기
-
PubMine: An Ontology-Based Text Mining System for Deducing Relationships among Biological Entities
Kim. Tae-Kyung, Oh. Jeong-Su, Ko. Gun-Hwan, Cho. Wan-Sup, Hou. Bo-Kyeng, Lee. Sang-Hyuk 한국생물정보시스템생물학회 Interdisciplinary Bio Central 2 Pages
한국생물정보시스템생물학회 Interdisciplinary Bio Central 2011, Vol.3 No.2 7-8 (2 pages)
-
A Design of K-XMDR Search System Using Topic Maps
Jialei. Zhang, Hwang. Chi-Gon, Jung. Gye-Dong, Choi. Young-Keun 한국정보통신학회 International journal of maritime information and communication sciences 8 Pages
한국정보통신학회 International journal of maritime information and communication sciences 2011, Vol.9 No.3 287-294 (8 pages)
-
Charting the proteome of Cryptosporidium parvum sporozoites using sequence similarity-based BLAST searching
A.M.A.M.Z. Siddiki*, Jonathan M. Wastling 대한수의학회 Journal of Veterinary Science 8 Pages
대한수의학회 Journal of Veterinary Science 2009, 제 10권 제 3호 5 203-210 (8 pages)
MS data from the 1D-SDS-PAGE with LC-MS/MS analysis and a separate multi-dimensional protein identification technology (MudPIT) analysis of whole sporozoite lysate. Alongside the use of MASCOT search software for analysis of MS data, the MS BLAST search protocol has been used to optimize the use of peptide sequence information derived after MS analyses. Materials and Methods Chemicals and... is a database search protocol for identifying unknown proteins by sequence similarity to homologous proteins using peptide sequences produced by mass spectrometry. We have used several complementary approaches to explore the global sporozoite proteome of C. parvum with available proteomic tools. To optimize the output of the MS data, a sequence similarity-based MS BLAST strategy was employed for bioinformatic analysis. Most significantly, almost all the constituents of glycolysis and several... -
Mass Spectrometry Based Quantitative Proteomic Profiling of Hepatocellular Carcinoma Cell Line
Suchismita Raha, Ho Jeong Lee, Venu Venkatarame Gowda Saralamma, Silvia Yumnam, Jeong Doo Heo, Sang Joon Lee, Eun Hee Kim, Gon Sup Kim 대한수의학회 대한수의학회 학술대회발표집 2 Pages
대한수의학회 대한수의학회 학술대회발표집 춘계학술심포지움 92 134-135 (2 pages)
used to search against the Swiss Prot database using the Mascot program (http:// ..PAGE:2 Vol. 56, No. 1 Supplement 135 matrixscience. com). Identified proteins were submitted to GO Retriever (http://www.agbase.msstate.edu/) to obtain the GO annotations. Gene ontology derived protein names were submitted to STRING database for protein interaction. Results: In order to identify the protein for... -
A two-component signal transduction system contributes to the virulence of Riemerella anatipestifer
Qing Wang, Mianmian Chen, Wei Zhang 대한수의학회 Journal of Veterinary Science 11 Pages
대한수의학회 Journal of Veterinary Science 2018, 제 19권 제 2호 12 260-270 (11 pages)
A search for virulence genes of Haemophilus parasuis using differential display RT-PCR. Vet Microbiol 2003, 96, 189-202. 13. Hollenstein K, Dawson RJ, Locher KP. Structure and mechanism of ABC transporter proteins. Curr Opin Struct Biol 2007, 17, 412-418. 14. Hu Q, Han X, Zhou X, Ding C, Zhu Y, Yu S. OmpA is a ..PAGE:11 270 Qing Wang et al. Journal of Veterinary Science virulence factor of... Similar to other studies of bacterial pathogens, current studies of the pathogenesis of Riemerella anatipestifer (RA) are focused mainly on in vitro culture conditions. To elucidate further the pathogenesis of RA in vivo, bacterial RNA was extracted from overnight tryptic soy broth cultures (in vitro) and from the blood of infected ducks (in vivo) for comparative RNA sequencing analysis. In total, 682 upregulated genes were identified in vivo. Among the upregulated genes, a signal transduction... -
Time-dependent proteomic and genomic alterations in Toll-like receptor-4-activated human chondrocytes: increased expression of lamin A/C and annexins
SeungHeeHa, HyoungKyuKim, NguyenThiTuyetAnh, NariKim, KyungSooKo, ByoungDooRhee, JinHan 대한생리학회-대한약리학회 The Korean Journal of Physiology & Pharmacology 16 Pages
대한생리학회-대한약리학회 The Korean Journal of Physiology & Pharmacology 2017, Vol.21 No.5 8 531-546 (16 pages)
(p<0.05), compared with matched control proteins, were selected for further analysis and identification. The search program MASCOT (http://www.matrixscience. com/cgi/ search_form.pl?FORMVER=2&SEARCH=PMF) was used for protein identification by peptide mass fingerprinting. Spectra were calibrated with trypsin auto-digestion ion peak m/z (842.510, 2211.1046) as internal standards. The quality of... Activation of Toll-like receptor-4 (TLR-4) in articular chondrocytes increases the catabolic compartment and leads to matrix degradation during the development of osteoarthritis. In this study, we determined the proteomic and genomic alterations in human chondrocytes during lipopolysaccharide (LPS)-induced inflammation to elucidate the underlying mechanisms and consequences of TLR-4 activation. Human chondrocytes were cultured with LPS for 12, 24,and 36 h to induce TLR-4 activation. The... -
NecroX-5 protects mitochondrial oxidative phosphorylation capacity and preserves PGC1α expression levels during hypoxia/ reoxygenation injury
VuThiThu, HyoungKyuKim, LeThanhLong, BayalagmaaNyamaa, In-SungSong, ToThanhThuy, NguyenQuangHuy, JubertMarquez, SoonHaKim, NariKim, KyungS 대한생리학회-대한약리학회 The Korean Journal of Physiology & Pharmacology 11 Pages
대한생리학회-대한약리학회 The Korean Journal of Physiology & Pharmacology 2016, Vol.20 No.2 9 201-211 (11 pages)
(Search Tool for the Retrieval of Interacting Genes/ Proteins), Cytoscape and ClueGo. Western blot Protein extracts from myocardial tissues were homogenized Table 1. Primer list of the examined genes Gene ID Full gene name Forword primer Reverse primer NDUFV2 NADH dehydrogenase flavoprotein 2, mitochondrial tctctgccatgaacaaggtg cgtttacacaggcccctaaa IDH3A Idh3a: Isocitrate dehydrogenase subunit... Although the antioxidant and cardioprotective effects of NecroX-5 on various in vitro and in vivo models have been demonstrated, the action of this compound on the mitochondrial oxidative phosphorylation system remains unclear. Here we verify the role of NecroX-5 in protecting mitochondrial oxidative phosphorylation capacity during hypoxia-reoxygenation (HR). Necrox-5 treatment (10 μM) and non-treatment were employed on isolated rat hearts during hypoxia/ reoxygenation treatment using an ex... -
Necrotrophic Fungus Pyrenophora tritici-repentis Triggers Expression of Multiple Resistance Components in Resistant and Susceptible Wheat Cultivars
Ethan J. Andersen, Madhav P. Nepal, Shaukat Ali 한국식물병리학회 The Plant Pathology Journal 16 Pages
한국식물병리학회 The Plant Pathology Journal 2021, 37권 2호 2 99-114 (16 pages)
or Salamouni, indicating that further re- search could target those only expressed in Salamouni. We acknowledge that our analyses focused on the genes that possess functions associated with pathogen resistance, not including the many other genes differentially expressed Fig. 6. Nucleotide-binding and leucine-rich repeat (NLR)encoding genes that were differentially expressed between cultivars... Tan spot of wheat, caused by Pyrenophora tritici-re- pentis (Ptr), results in a yield loss through chlorosis and necrosis of healthy leaf tissue. The major objective of this study was to compare gene expression in resistant and susceptible wheat cultivars after infection with Ptr ToxA-producing race 2 and direct infiltration with Ptr ToxA proteins. Greenhouse experiments included ex- posure of the wheat cultivars to pathogen inoculum or direct infiltration of leaf tissue with Ptr-ToxA protein...